[NTG-context] Wiki - question about Command/ pages which start with a space character

2024-04-14 Thread garulfo
startbuffer Command/ startcolumnset Command/ startcomment Command/ startdelimitedtext Command/ startdescription Command/ starteffect Command/ startenumeration Command/ startfittingpage Command/ startfloattext Command/ startformula Command/ startframedtext Command/ starthelp Command/ start

[NTG-context] \intertext and highlighting with \alignhere/\breakhere

2024-03-12 Thread Max Chernoff
ad[section][page=yes] \unprotect \newbox\intertext_tmp_box \newdimen\intertext_tmp_dimen \starttexdefinition protected newintertext #1 \texthere[left]{ \setbox\intertext_tmp_box=\hbox{ \startframedtext[ offset=none, width=\hsize,

[NTG-context] XML processing, unwanted indentation/alignment

2024-02-15 Thread Michael Guravage
pxmlsetups \xmlregisterdocumentsetup{list}{xml:list:base} % When we encounter the root element merely flush the rest. \startxmlsetups xml:list:addressBook \xmlflush{#1} \stopxmlsetups % Place each family in a frametext box \startxmlsetups xml:list:family \startframedtext[width=\textwidth] {\tfb \bf \xmlatt{#

[NTG-context] Re: textbackground spacing offset

2024-01-31 Thread Hans Hagen
=paragraph, %% offset=overlay, %% does nothing %% backgroundoffset=overlay, %% does nothing %% depthcorrection=off, %% does nothing %% topoffset=3mm,%% works, but only for positive values background=, frame=on] \starttext \startframedtext

[NTG-context] Re: textbackground spacing offset

2024-01-31 Thread Marco Patzer
tion=paragraph, >%% offset=overlay, %% does nothing >%% backgroundoffset=overlay, %% does nothing >%% depthcorrection=off, %% does nothing >%% topoffset=3mm,%% works, but only for positive values >background=, > frame=on] >

[NTG-context] About framedtext

2023-12-13 Thread Fabrice Couvreur
=, after=, text=Info, title=no, width=fit, distance=0.5em, headcommand=\FrameTitle, alternative=serried] \starttext \startFramedText[width=5cm] \startInfo \input{ward} \stopInfo \stopFramedText \stoptext

[NTG-context] textbackground spacing offset

2023-11-16 Thread Marco Patzer
nothing %% depthcorrection=off, %% does nothing %% topoffset=3mm,%% works, but only for positive values background=, frame=on] \starttext \startframedtext \framed{Foo} \stopframedtext \starttextbackground \framed{Foo} \stoptextbackground \stoptext How do

[NTG-context] TOC with sections titles and page numbers like a paragraph beneath chapter

2023-09-04 Thread jbf
,section}] \startsetups [SecToc] \startframedtext [width=\textwidth, align=middle, frame=off] \placelist [section] [ criterium=chapter, ] \stopframedtext \stopsetups While that produces a result, it is nothing like what I want above. Has anyone put together a TOC of this kind and might

[NTG-context] Re: empty line before typebuffer

2023-07-30 Thread Henning Hraban Ramm
er \framedtext{\typebuffer[option=tex]} \stoptext """ \framedtext[strut=no]{\typebuffer[option=tex]} or \startframedtext \typebuffer[option=tex] \stopframedtext Thank you (also Jacob)! Seems like I didn’t lo

[NTG-context] Re: empty line before typebuffer

2023-07-30 Thread Wolfgang Schuster
ex]} \stoptext """ \framedtext[strut=no]{\typebuffer[option=tex]} or \startframedtext \typebuffer[option=tex] \stopframedtext Wolfgang ___ If your question is of interest to others as well, please add an entry

Re: [NTG-context] \placeinitial doesn't work inside \framedtext (or \framed)

2023-05-16 Thread 李延瑞
nitial\input knuth > > \framed[align=flushleft]{\setupinitial[n=2,text=Knuth]\placeinitial\input > knuth > } > > \framedtext[align=flushleft]{\setupinitial[n=2,text=Knuth]\placeinitial\input > knuth > } > > \stoptext > %====== > > There is a wor

[NTG-context] Unwanted space with \startframedtext

2022-12-21 Thread Max Chernoff via ntg-context
Hi Hans, There's an uncommented linebreak in the definition of \pack_framed_text_start that's introducing an unwanted space just before \startframedtext. Minimal example: \showmakeup[space] \starttext \hbox{.\startframedtext.\stopframedtext} \stoptext Patch: --- texmf

Re: [NTG-context] Forbid footnotes from splitting across pages

2022-08-03 Thread Hamid,Idris via ntg-context
Dear Pablo, Many thanks and apologies for top-posting: my normal email client is currently down. I thought of something similar; after some testing, this is what I finally came up with: \setupwhitespace[medium] \setupnotation[footnote] [before={% \startframedtext[none][frame=on,offset

Re: [NTG-context] issue with framed texts

2022-04-25 Thread Wolfgang Schuster via ntg-context
to the backcover framed text. [...] While you can pass a instance to \starframed (e.g. \startframed[backcover]) the same isn't possible with \startframedtext. Many thanks for your reply, Wolfgang. I thought I could do that, because http://www.pragma-ade.com/general/qrcs/setup-en.pdf seems to allow

Re: [NTG-context] issue with framed texts

2022-04-25 Thread Pablo Rodriguez via ntg-context
[...] > While you can pass a instance to \starframed (e.g. > \startframed[backcover]) the same isn't possible with \startframedtext. Many thanks for your reply, Wolfgang. I thought I could do that, because http://www.pragma-ade.com/general/qrcs/setup-en.pdf seems to allow it.

Re: [NTG-context] issue with framed texts

2022-04-24 Thread Wolfgang Schuster via ntg-context
Pablo Rodriguez via ntg-context schrieb am 24.04.2022 um 20:56: Dear list, I have the following sample: \defineframedtext[backcover] \setupframedtext[backcover] [frame=off, offset=overlay, width=\textwidth] \starttext \startframedtext[backcover] \input

[NTG-context] issue with framed texts

2022-04-24 Thread Pablo Rodriguez via ntg-context
Dear list, I have the following sample: \defineframedtext[backcover] \setupframedtext[backcover] [frame=off, offset=overlay, width=\textwidth] \starttext \startframedtext[backcover] \input zapf \stopframedtext \stoptext Using current LMTX (2022.04.20 19:18

Re: [NTG-context] Switching fonts changes framedtext justification

2022-04-05 Thread Pablo Rodriguez via ntg-context
the OTF, the > emojis appear, but the text is unjustified. Both things work on both Linux and Windows systems. \definefontfamily[emoj][rm][OpenSansEmoji] \setupbodyfont[emoj] \starttext \startTEXpage[offset=1em, align=center] Welcome to the future,\\human ! \stopTEXpage \start

[NTG-context] Switching fonts changes framedtext justification

2022-04-02 Thread Thangalin via ntg-context
Hi all, The following code produces framed text areas, each having different justification: \definefont [TextFontEmoji] [OpenSansEmoji] \definefontfamily [TextFont] [rm] [LibreBaskerville] \setupbodyfont [TextFont] \starttext \startframedtext \TextFontEmoji \input ward

Re: [NTG-context] Indented Paragraph After Float?

2022-02-07 Thread śrīrāma via ntg-context
agraph. A fix is to use \indentation after \stopplacefigure. \setupfloat[figure][indentnext=yes] \starttext %\setupbodyfont[11pt] \setupindenting[yes, medium] \input ward \endgraf \startplacefigure[title=A Figure,location={page,auto}] \startframedtext \input wa

[NTG-context] Indented Paragraph After Float?

2022-02-07 Thread Michael Urban via ntg-context
As always, it is hard to tell whether this is my stupidity, the wrong version of ConText, or a bug. \setupfloat[figure][indentnext=yes] \starttext %\setupbodyfont[11pt] \setupindenting[yes, medium] \input ward \startplacefigure[title=A Figure,location=page] \startframedtext \input ward.tex

Re: [NTG-context] Extra shift with ornament

2021-12-17 Thread Mikael Sundqvist via ntg-context
On Fri, Dec 17, 2021 at 10:05 AM Hans Hagen wrote: > > On 12/17/2021 6:40 AM, Mikael Sundqvist via ntg-context wrote: > > Hi, > > > > When using an ornament on a \startframedtext \stoptextframed the frame > > is shifted just a little bit. Can one get ri

Re: [NTG-context] Extra shift with ornament

2021-12-17 Thread Hans Hagen via ntg-context
On 12/17/2021 6:40 AM, Mikael Sundqvist via ntg-context wrote: Hi, When using an ornament on a \startframedtext \stoptextframed the frame is shifted just a little bit. Can one get rid of that shift? MWE below. /Mikael \defineornament[MyOrn][ corner={right,bottom}, location={right,top

[NTG-context] Extra shift with ornament

2021-12-16 Thread Mikael Sundqvist via ntg-context
Hi, When using an ornament on a \startframedtext \stoptextframed the frame is shifted just a little bit. Can one get rid of that shift? MWE below. /Mikael \defineornament[MyOrn][ corner={right,bottom}, location={right,top}, alternative=b, ][ frame=off, ] \showframe \starttext

Re: [NTG-context] Framedtext : text out of frame

2021-09-26 Thread Hans Hagen via ntg-context
On 9/26/2021 5:07 PM, Fabrice Couvreur via ntg-context wrote: Hi, How to fix the small problem in the code below where the text goes out of the frame ? Thanks Fabrice \usecolors[x11] \starttext   \startframedtext[frame=off,width=\textwidth, align={broad,right},indenting={yes},background

[NTG-context] Framedtext : text out of frame

2021-09-26 Thread Fabrice Couvreur via ntg-context
Hi, How to fix the small problem in the code below where the text goes out of the frame ? Thanks Fabrice \usecolors[x11] \starttext \startframedtext[frame=off,width=\textwidth, align={broad,right},indenting={yes},background=color,backgroundcolor=navajowhite1] \startitemize[columns,three

Re: [NTG-context] Vertical offset in framedtext has changed

2021-08-12 Thread Christoph Reller via ntg-context
On Mon, Aug 9, 2021 at 6:32 AM Christoph Reller wrote: > Somewhere between versions 2021-07-06 and 2021-07-30 the vertical > top-offset in framedtext has changed. Consider the MWE: > \starttext > \startframedtext > Bla > \stopframedtext > \stoptext > [...] > Is this

[NTG-context] Vertical offset in framedtext has changed

2021-08-08 Thread Christoph Reller via ntg-context
Hi, Somewhere between versions 2021-07-06 and 2021-07-30 the vertical top-offset in framedtext has changed. Consider the MWE: \starttext \startframedtext Bla \stopframedtext \stoptext Output 2021-07-06: [image: FramedText-ConTeXt-2021-07-06.png] Output 2021-07-30 (and later): [image

Re: [NTG-context] footnote not appearing

2021-07-28 Thread jbf via ntg-context
: Is there any reason why the following MWE does not produce the footnote at the bottom of the page? It seems like the use of framedtext is preventing it, but am not sure why. Can I get around this problem and still have framed text? Julian \setupframed[location=middle] \startframedtext[width=.77

Re: [NTG-context] footnote not appearing

2021-07-28 Thread Hans Hagen via ntg-context
why. Can I get around this problem and still have framed text? Julian \setupframed[location=middle] \startframedtext[width=.77\makeupwidth,corner=round] The poems of St John of the Cross have been important for me in recent years. This is John’s prayer from a verse in his Spiritual Canticle

Re: [NTG-context] footnote not appearing

2021-07-27 Thread jbf via ntg-context
and still have framed text? Julian \setupframed[location=middle] \startframedtext[width=.77\makeupwidth,corner=round] The poems of St John of the Cross have been important for me in recent years. This is John’s prayer from a verse in his Spiritual Canticle:\footnote{John of the Cross, {\em

Re: [NTG-context] footnote not appearing

2021-07-27 Thread Henning Hraban Ramm via ntg-context
ave framed text? > > Julian > > \setupframed[location=middle] > > \startframedtext[width=.77\makeupwidth,corner=round] > The poems of St John of the Cross have been important for me in recent years. > This is John’s prayer from a verse in his Spiritual Canticle:\footno

[NTG-context] footnote not appearing

2021-07-26 Thread jbf via ntg-context
Is there any reason why the following MWE does not produce the footnote at the bottom of the page? It seems like the use of framedtext is preventing it, but am not sure why. Can I get around this problem and still have framed text? Julian \setupframed[location=middle] \startframedtext[width

Re: [NTG-context] keep text strictly inside box

2021-06-08 Thread Wolfgang Schuster
Taco Hoekwater schrieb am 08.06.2021 um 08:42: On 7 Jun 2021, at 23:07, Wolfgang Schuster wrote: Use the align key. \starttext \startframedtext[width=10cm,align={flushleft,nothyphenated}] Also, ‘verytolerant’ helps: align={flushleft,nothyphenated,verytolerant}] Another option

Re: [NTG-context] keep text strictly inside box

2021-06-08 Thread Taco Hoekwater
> On 7 Jun 2021, at 23:07, Wolfgang Schuster > wrote: > > Use the align key. > > \starttext > > \startframedtext[width=10cm,align={flushleft,nothyphenated}] Also, ‘verytolerant’ helps: > align={flushleft,nothyphenated,verytolerant}] Best wishes, Taco > >

Re: [NTG-context] keep text strictly inside box

2021-06-07 Thread Wolfgang Schuster
manually (a nuisance to be avoided, of course.) Use the align key. \starttext \startframedtext[width=10cm,align={flushleft,nothyphenated}] Martinus, zoon van Johannes van Zonnevelt en Johanna Teikenbort: getuigen Adrianus van Zonnevelt en Anna van Oostbroek. \stopframedtext \stoptext Wolfgang

Re: [NTG-context] Adding syntax highlighting when typesetting from xml (asciidoc/docbook)

2020-12-01 Thread Hans Hagen
dule would be the right approach here (since the built-in parser only has support for a limited set of languages), but I'm not exactly sure about the implementation to achieve that goal. I started with \startxmlsetups xml:programlisting \dontleavehmode \startframedtext[background=color,backg

[NTG-context] Adding syntax highlighting when typesetting from xml (asciidoc/docbook)

2020-11-30 Thread Mojca Miklavec
arser only has support for a limited set of languages), but I'm not exactly sure about the implementation to achieve that goal. I started with \startxmlsetups xml:programlisting \dontleavehmode \startframedtext[background=color,backgroundcolor=lightgray] \obeylines \tt \x

[NTG-context] MP background for text typeset by \typefile

2020-11-05 Thread context
,backgroundcolor=blue] }, after={\stopbackground }, ] - which creates a rectangular backround to the text, and the text may spread over pages; 2. or this: \defineoverlay[AnOverlayDefinition][] \definetyping[Test] [before={\startframedtext[background=AnOverlayDefinition

[NTG-context] troubles with \enablemode

2020-10-30 Thread Damien Thiriet
Hi @list, I don't fully understand the \enablemode mechanism. Given this MWE: \startmode[test] \setupframedtext [foregroundcolor=white,style={\tfa}] \stopmode \starttext \startframedtext ceci est un texte \stopframedtext \enablemode [test] \startframedtext ceci est un texte \stopframedtext

[NTG-context] [save] [setmatrix] [restore] and [latelua] messages on terminal

2020-10-30 Thread Aditya Mahajan
them. Here is a minimal example for the second message and I can also try to create one for the first: \starttext \startframedtext \startTABLE \NC \input knuth \NC[nr=2] \iftrialtypesetting\else\startplacefigure [location={right,high}, title={Blah blah blah

Re: [NTG-context] troubles with \enablemode

2020-10-30 Thread Aditya Mahajan
On Fri, 30 Oct 2020, Damien Thiriet wrote: > Hi @list, > > > I don't fully understand the \enablemode mechanism. Given this MWE: > > > \startmode[test] > \setupframedtext [foregroundcolor=white,style={\tfa}] > \stopmode > > > \starttext &g

Re: [NTG-context] troubles with \enablemode

2020-10-30 Thread Henning Hraban Ramm
> Am 30.10.2020 um 19:26 schrieb Damien Thiriet : > I don't fully understand the \enablemode mechanism. Given this MWE: > > \startmode[test] > \setupframedtext [foregroundcolor=white,style={\tfa}] > \stopmode > > > \starttext > \startframedtext > ce

Re: [NTG-context] Fullwidth topfigure with caption in the margin

2020-09-08 Thread Mikael Sundqvist
, maxwidth=6.5in, ] \setupcaption[topfigure][ number=no, ] \define\TopFigureCaption{% \blank[-line,force,overlay] \vsmash{% \blank[line] \framed[align=flushright,width=6.5in,frame=off,offset=overlay]{% \startframedtext[ width=\rightmarginwidth, frame=off, offset=overlay, style={\switch

Re: [NTG-context] Text around a figure

2020-07-16 Thread Otared Kavian
gt; > wrote: > > > > Fabrice Couvreur schrieb am 15.07.2020 um 19:54: > >> Hello, > >> I always encounter difficulties with the placement of figures in such a > >> way that the text envelops the figure. > >> Thank you. > >> Fabrice > &g

Re: [NTG-context] Text around a figure

2020-07-16 Thread Fabrice Couvreur
> >> I always encounter difficulties with the placement of figures in such a > way that the text envelops the figure. > >> Thank you. > >> Fabrice > >> \useMPlibrary[dum] > >> \definecolor[fondpaille][c=0,m=0,y=0.2,k=0] > >> \starttext >

Re: [NTG-context] Text around a figure

2020-07-15 Thread Otared Kavian
you. >> Fabrice >> \useMPlibrary[dum] >> \definecolor[fondpaille][c=0,m=0,y=0.2,k=0] >> \starttext >> \startframedtext[width=max,background=color,backgroundcolor=fondpaille] >> \placefloat[][right,none]{} >>{\externalfigure[dummy]} >

Re: [NTG-context] Text around a figure

2020-07-15 Thread Wolfgang Schuster
Fabrice Couvreur schrieb am 15.07.2020 um 19:54: Hello, I always encounter difficulties with the placement of figures in such a way that the text envelops the figure. Thank you. Fabrice \useMPlibrary[dum] \definecolor[fondpaille][c=0,m=0,y=0.2,k=0] \starttext \startframedtext[width=max

[NTG-context] Text around a figure

2020-07-15 Thread Fabrice Couvreur
Hello, I always encounter difficulties with the placement of figures in such a way that the text envelops the figure. Thank you. Fabrice \useMPlibrary[dum] \definecolor[fondpaille][c=0,m=0,y=0.2,k=0] \starttext \startframedtext[width=max,background=color,backgroundcolor=fondpaille

Re: [NTG-context] Store images and text in the right margin

2020-07-06 Thread Fabrice Couvreur
eringsetup=userdata:margintext] > > \startsetups [userdata:margintext] > \margindata > [inright] > [style={\switchtobodyfont[9pt]}, > width=\rightmarginwidth, > align={flushleft,broad}, > stack=yes] > {\startframedtext[before=,after=,offse

Re: [NTG-context] Store images and text in the right margin

2020-07-06 Thread Taco Hoekwater
=userdata:margintext] \startsetups [userdata:margintext] \margindata [inright] [style={\switchtobodyfont[9pt]}, width=\rightmarginwidth, align={flushleft,broad}, stack=yes] {\startframedtext[before=,after=,offset=0pt,width=max,frame=off] \getinlineuserdata

Re: [NTG-context] Typesetting poetry with particular indenting

2020-07-02 Thread Wolfgang Schuster
={\startframedtext[location=middle,width=fit,offset=none,frame=off]}, after={\stopframedtext}, indentlist={0em,1em,1em}] \starttext \startpoem Per correr miglior acque alza le vele omai la navicella del mio ingegno, che lascia dietro a sé mar sì crudele; e canterò di quel secondo regno dove l'umano

Re: [NTG-context] Typesetting poetry with particular indenting

2020-07-02 Thread Wolfgang Schuster
\startframedtext[middle][frame=off,width=fit] \startlines Per correr miglior acque alza le vele omai la navicella del mio ingegno, che lascia dietro a sé mar sì crudele; e canterò di quel secondo regno dove l'umano spirito si purga e di salire al ciel diventa degno. \stoplines \stopframedtext \stoptext Wolfgang

Re: [NTG-context] \startplacefigure and \startframedtext in lmtx

2020-06-10 Thread mf
Il 10/06/20 17:30, Hans Hagen ha scritto: On 6/9/2020 11:04 AM, Otared Kavian wrote: Hi all, I just noticed that in lmtx, the commands \startplacefigure and \startframedtext, when used together, do not behave in the same way as they do in mkiv. I wonder whether this is a permanent change

Re: [NTG-context] \startplacefigure and \startframedtext in lmtx

2020-06-10 Thread Wolfgang Schuster
Hans Hagen schrieb am 10.06.2020 um 17:30: On 6/9/2020 11:04 AM, Otared Kavian wrote: Hi all, I just noticed that in lmtx, the commands \startplacefigure and \startframedtext, when used together, do not behave in the same way as they do in mkiv. I wonder whether this is a permanent change

Re: [NTG-context] \startplacefigure and \startframedtext in lmtx

2020-06-10 Thread Hans Hagen
On 6/9/2020 11:04 AM, Otared Kavian wrote: Hi all, I just noticed that in lmtx, the commands \startplacefigure and \startframedtext, when used together, do not behave in the same way as they do in mkiv. I wonder whether this is a permanent change or rather a buglet. I found a fix around

Re: [NTG-context] \startplacefigure and \startframedtext in lmtx

2020-06-10 Thread Otared Kavian
ote: > > Hi all, > > I just noticed that in lmtx, the commands \startplacefigure and > \startframedtext, when used together, do not behave in the same way as they > do in mkiv. > I wonder whether this is a permanent change or rather a buglet. > > I found a fix aro

[NTG-context] \startplacefigure and \startframedtext in lmtx

2020-06-09 Thread Otared Kavian
Hi all, I just noticed that in lmtx, the commands \startplacefigure and \startframedtext, when used together, do not behave in the same way as they do in mkiv. I wonder whether this is a permanent change or rather a buglet. I found a fix around the issue, but since in my document I have

Re: [NTG-context] start/stop executed conditionally on mode ?

2020-06-08 Thread Fabrice L
defined. So when ConTeXt encounters the \startQuestions / \stopQuestions, if the « ClassRoom » mode is enabled, the buffer is processed (with some format if needed - framed here for the example), and if the mode « ClassRoom » is disabled, then nothing is process. You can add as many \startQuestions / \stopQuestions you wish. % ---

Re: [NTG-context] Text to be placed into the free space after columns and end of the page

2020-05-22 Thread context
use \setupnarrower[right=0.5\textwidth] \startnarrower[right] \input knuth \stopnarrower or to get right frame: \startframedtext[width=0.45\textwidth,frame=off, rightframe=on, roffset=0.5em] \input knuth \stopframedtext Aditya __

Re: [NTG-context] Text to be placed into the free space after columns and end of the page

2020-05-21 Thread Aditya Mahajan
a single column), you can use \setupnarrower[right=0.5\textwidth] \startnarrower[right] \input knuth \stopnarrower or to get right frame: \startframedtext[width=0.45\textwidth,frame=off, rightframe=on, roffset=0.5em] \input

Re: [NTG-context] Shift tabulate into margin and center

2020-05-05 Thread Tim Steenvoorden
r=0pc, > height=49pc, > footer=0pc, > bottomdistance=2.5pc, > bottom=1pc, > location=middle] > > \define\fullwidth{\dimexpr(\leftmargindistance+\leftmarginwidth+\textwidth)} > > \section{First} > \subsection{First first} > > \input tufte > > \setupnarrower[left=

[NTG-context] Shift tabulate into margin and center

2020-05-04 Thread Tim Steenvoorden
=middle] \define\fullwidth{\dimexpr(\leftmargindistance+\leftmarginwidth+\textwidth)} \section{First} \subsection{First first} \input tufte \setupnarrower[left=-9pc] \startnarrower[left] \startframedtext[frame=off,topframe=on,bottomframe=on,align=middle,width=\fullwidth] The whole frame should

Re: [NTG-context] Setting vertical spacing of lines inside a \framed[align=]

2020-04-24 Thread Gerben Wierda
t; > \starttext > > \startframed > \samplefile{knuth} > \stopframed > > \startframed[width=max,align=normal] > \samplefile{knuth} > \stopframed > > \stoptext > > or do you want to change to change the spacing > > \starttext > > \startframedtext[widt

Re: [NTG-context] Setting vertical spacing of lines inside a \framed[align=]

2020-04-24 Thread Wolfgang Schuster
want to have a linebreak at the end of the frame \starttext \startframed \samplefile{knuth} \stopframed \startframed[width=max,align=normal] \samplefile{knuth} \stopframed \stoptext or do you want to change to change the spacing \starttext \startframedtext[width=max,style

Re: [NTG-context] Hyphentation/Linebreak after x characters

2020-04-24 Thread Benjamin Buchmuller
gt;> right = false, >> } >> >> local all = table.setmetatableindex({ }, function(t,k) >> return shared >> end) >> >> languages.hyphenators.traditional.installmethod("dna", >> f

Re: [NTG-context] Hyphentation/Linebreak after x characters

2020-04-23 Thread Rik Kabel
ary,word,n) return all end ) \stopluacode \definehyphenationfeatures   [dna]   [characters=all,    alternative=dna] \starttext \startframedtext[width=6cm,style=mono]   \sethyphenationfeatures[dna]   \setuphyphenation[method=traditional]   GATTGCTTAC

Re: [NTG-context] Hyphentation/Linebreak after x characters

2020-04-23 Thread Benjamin Buchmuller
> > languages.hyphenators.traditional.installmethod("dna", > function(dictionary,word,n) > return all > end > ) > \stopluacode > > \definehyphenationfeatures > [dna] > [characters=all, > alternative=dna] > >

Re: [NTG-context] Hyphentation/Linebreak after x characters

2020-04-23 Thread Wolfgang Schuster
end ) \stopluacode \definehyphenationfeatures [dna] [characters=all, alternative=dna] \starttext \startframedtext[width=6cm,style=mono] \sethyphenationfeatures[dna] \setuphyphenation[method=traditional] GATTGCTTACTCCTGGTTGG% TCTTACATTCTGTCGCCTC% CTACTAGAG

Re: [NTG-context] Background color of a framedtext that covers floats

2020-04-08 Thread Pablo Rodriguez
On 4/8/20 11:32 AM, Fabrice Couvreur wrote: > [...] > \startframedtext[width=max,background=color,backgroundcolor=fondpaille] >      \starthanging[location=right] >          {\startMPcode >           draw unitsquare scaled 2cm ; >           \stopMPcode} >      \input tuft

Re: [NTG-context] Background color of a framedtext that covers floats

2020-04-08 Thread Fabrice Couvreur
Hi Pablo, Here a sample. Fabrice \useMPlibrary[dum] \definecolor[fondpaille][c=0,m=0,y=0.2,k=0] \starttext \startframedtext[width=max,background=color,backgroundcolor=fondpaille] \starthanging[location=right] {\startMPcode draw unitsquare scaled 2cm

[NTG-context] Background color of a framedtext that covers floats

2020-04-08 Thread Fabrice Couvreur
\startframedtext [frame=off,width=\textwidth, background=color,backgroundcolor=fondpaille] \input tufte \startlinecorrection[blank] \startmidaligned \startxtable [align={lohi,middle}, option={stretch},framecolor=cyan, offset=0.8ex,background=color,backgroundcolor

Re: [NTG-context] Bounding box of picture returned by textext() in METAPOST

2020-04-05 Thread Gerben Wierda
ave p; picture p; > p := textext( "\startframedtext[middle]" & > "[align=middle,frame=on" & > ",width=" & tostring 0.8w & "bp" & > ",height=" & tostring 0.8h & "bp]" & > name & "\sto

[NTG-context] Bounding box of picture returned by textext() in METAPOST

2020-04-04 Thread Gerben Wierda
I have this METAPOST macro: vardef makeTeXLabel( expr w, h, name) = if debugProgram or debugLabels: show "NAME makeTeXLabel:", name, tostring 0.8w, tostring 0.8h; fi save p; picture p; p := textext( "\startframedtext[middle]" & "[align=middle,frame=on&quo

[NTG-context] Global \setup has no effect while ad-hoc setting does

2020-02-13 Thread Exp
Dear list, I want to prevent an overfull hbox caused by an inline typing by making the alignment very tolerant, but it didn't work: ``` \setupframedtext[ width=broad, align={verytolerant, stretch} ] \starttext \startframedtext%[align={verytolerant, stretch}] xx. x xx- xx

Re: [NTG-context] line numbering within frame

2020-01-25 Thread Wolfgang Schuster
mple # Line numbering Line numbering in MkIV happens at a different point as it did in MkII. When you use line numbers for \framed (or \startframedtext) ConTeXt adds the numbers to the frame after the framed box is completed. When the framed content is put in the box you're always withi

Re: [NTG-context] multipage typing

2020-01-19 Thread Hans Hagen
On 1/19/2020 12:59 PM, Tomas Hala wrote: Hi all, content of typing environment is automatically broken at the end of a page, so is it no problem to typeset multipage code. But when I used startframedtext inside (see below), the multipage code was suppressed. Is there any way how to get over

[NTG-context] multipage typing

2020-01-19 Thread Tomas Hala
Hi all, content of typing environment is automatically broken at the end of a page, so is it no problem to typeset multipage code. But when I used startframedtext inside (see below), the multipage code was suppressed. Is there any way how to get over it? Best wishes, Tomáš \setupstartstop

Re: [NTG-context] Tent style cards

2019-12-21 Thread Pablo Rodriguez
bottomspace=0in, footer=0in, backspace=0.0in, %% location=middle, marking=on, ] \startbuffer[tblcard] \startframedtext [frame=off, width=\textwidth, height=\textheight, align={lohi, middle}] \tfd A Name

Re: [NTG-context] Text and tree side by side in a framedtext environment

2019-11-17 Thread Fabrice Couvreur
> side, but it does not work. > Thanks for your help. > Fabrice > > \usemodule[tikz] > \usetikzlibrary[trees] > > \definefloat > [recipe] > [figure] > > \setupfloat > [recipe] > [default={right,nonumber}] > \starttext > \startframed

[NTG-context] Text and tree side by side in a framedtext environment

2019-11-16 Thread Fabrice Couvreur
\startframedtext[width=\textwidth] \placerecipe{}{ \hbox{ \starttikzpicture [level 1/.style={level distance=20mm,sibling distance=15mm}, level 2/.style={level distance=20mm,sibling distance=10mm}] \node{}[grow=right] child {node{\tfxx Réglisse

Re: [NTG-context] Horizontal space and framedtext

2019-11-03 Thread Fabrice Couvreur
space[]. Nevertheless, it does not work with this : > > \usecolors[xwi] > \starttext > \startframedtext[width=fit,frame=off, > > background=color,backgroundcolor=paleturquoise] > > {\it lancers}\unknown > > {\it dé}\unknown > > Tant que {\it dé}\unknown Faire &

Re: [NTG-context] Horizontal space and framedtext

2019-11-03 Thread Wolfgang Schuster
Fabrice Couvreur schrieb am 03.11.2019 um 22:46: Hi Wolfgang, I know it takes a predefined argument, but I wanted to quote the name of the command as such  \hspace[]. Nevertheless, it does not work with this : \usecolors[xwi] \starttext \startframedtext[width=fit,frame=off,  background=color

Re: [NTG-context] Horizontal space and framedtext

2019-11-03 Thread Fabrice Couvreur
Hi Wolfgang, I know it takes a predefined argument, but I wanted to quote the name of the command as such \hspace[]. Nevertheless, it does not work with this : \usecolors[xwi] \starttext \startframedtext[width=fit,frame=off, background=color,backgroundcolor=paleturquoise] {\it lancers

[NTG-context] Horizontal space and framedtext

2019-11-03 Thread Fabrice Couvreur
Hello, The \hspace [ ] command has no effect in an environment framedtext. Why ? Thank you. Fabrice \usecolors[xwi] \starttext \startframedtext[width=fit,frame=off, background=color,backgroundcolor=paleturquoise] {\it lancers}\unknown {\it dé}\unknown Tant que {\it dé}\unknown Faire \hspace

Re: [NTG-context] issue splitting tables and horizontal mode

2019-10-20 Thread Wolfgang Schuster
    \startxcell xxx \stopxcell     \startxcell xxx \stopxcell     \stopxrow}     \stopxtable \stopplacefigure \stoptext Another option is framedtext which can be centered. \starttext \startframedtext [location=middle,width=fit,frame=off]     \startxtable     \startxrow

[NTG-context] Unexpected symbol with Enumeration

2019-10-15 Thread Fabrice Couvreur
\startFramedText[width=7cm] \startInfo \startitemize[1] \startitem La droite \m{(AM)} est {\bf une sécante} à la courbe {\setupbodyfont[xits]\m{{\mathscript C}}} en \m{A}. \stopitem \par \startitem La

Re: [NTG-context] poem as a sidefloat

2019-09-25 Thread Henning Hraban Ramm
> Am 2019-09-25 um 22:10 schrieb Wolfgang Schuster > : > > Henning Hraban Ramm schrieb am 25.09.2019 um 21:37: >> The following works, except: >> - There’s too much space (2 lines?) within the frame before the poem. > Use the framedtext environment. Ah, I did

Re: [NTG-context] poem as a sidefloat

2019-09-25 Thread Wolfgang Schuster
]   \startframedtext [frame=off,width=fit,offset=0.25ex]     \startlines [style=mono]     lichtung     manche meinen     lechts und rinks     kann man nicht     velwechsern.     werch ein illtum!     \wordright{ernst jandl}     \stoplines   \stopframedtext \stopplacefloat \dorecurse{2}{\samplefile

Re: [NTG-context] startnarrower and framed?

2019-08-21 Thread Jon Wong
gt;> >> >>> On Aug 21, 2019, at 9:25 PM, Jon Wong >> <mailto:jhannw...@gmail.com>> wrote: >>> >>> Hi all, >>> >>> Sorry, my solution didn’t work. >>> >>> My purpose of using \startnarrower is to have some par

Re: [NTG-context] startnarrower and framed?

2019-08-21 Thread Jon Wong
> > Regards > Jon > > >> On Aug 21, 2019, at 9:25 PM, Jon Wong > <mailto:jhannw...@gmail.com>> wrote: >> >> Hi all, >> >> Sorry, my solution didn’t work. >> >> My purpose of using \startnarrower is to have some paragraphs of t

Re: [NTG-context] startnarrower and framed?

2019-08-21 Thread Jon Wong
t; > Hi all, > > Sorry, my solution didn’t work. > > My purpose of using \startnarrower is to have some paragraphs of text inside > the \framed. Unfortunately, it seems \framed doesn’t take paragraphs. > > \startframedtext doesn’t have as many border options as

Re: [NTG-context] startnarrower and framed?

2019-08-21 Thread Jon Wong
Hi all, Sorry, my solution didn’t work. My purpose of using \startnarrower is to have some paragraphs of text inside the \framed. Unfortunately, it seems \framed doesn’t take paragraphs. \startframedtext doesn’t have as many border options as \framed. Should I use overlays? Or layers

[NTG-context] white space after a float in a column

2019-08-10 Thread Sytse knyps...@home.nl
\setuptolerance[verytolerant,stretch]
 \setupframedtexts[frame=on,corner=round,width=local] 
\setuplayout[grid=yes]
 \starttext
 \startcolumnset[Two]
 \input knuth \par 
 \placeintermezzo[bottom][]{}
 \startframedtext
 \input tufte \par
 \stopframedtext

Re: [NTG-context] placetable and localfootnotes

2019-05-01 Thread Wolfgang Schuster
} \startframedtext Two\footnote{Second footnote} \stopframedtext \startpostponingnotes \startframedtext Three\footnote{Second footnote} \stopframedtext \stoppostponingnotes \stoptext Wolfgang ___ If your question

Re: [NTG-context] How to repeat the hyphen?

2019-03-25 Thread Sam May
e is changed again. # > # > The following code works but I guess that must be some more sophisticated # > ConTeXt way. # > # > Best wishes, # > # > Tomá?? # > # > # > %% # > \def\myboxik#1#2{\start\setuphyphenation[cz][method=#1]\startframedtext[width=1dd]\hbox

Re: [NTG-context] How to repeat the hyphen?

2019-03-22 Thread Tomas Hala
sticated # > ConTeXt way. # > # > Best wishes, # > # > Tomáš # > # > # > %% # > \def\myboxik#1#2{\start\setuphyphenation[cz][method=#1]\startframedtext[width=1dd]\hbox{{\bf#1}}\crlf#2\stopframedtext\stop\par} # > \def\mybox#1{\myboxik{traditional}{#1}\myboxik{d

Re: [NTG-context] How to repeat the hyphen?

2019-03-22 Thread Taco Hoekwater
e is changed again. > > The following code works but I guess that must be some more sophisticated > ConTeXt way. > > Best wishes, > > Tomáš > > > %% > \def\myboxik#1#2{\start\setuphyphenation[cz][method=#1]\startframedtext[width=1dd]\hbox{{\bf#1}}\crlf#2\stopframe

Re: [NTG-context] How to repeat the hyphen?

2019-03-22 Thread Tomas Hala
\setuphyphenation[cz][method=#1]\startframedtext[width=1dd]\hbox{{\bf#1}}\crlf#2\stopframedtext\stop\par} \def\mybox#1{\myboxik{traditional}{#1}\myboxik{default}{#1}\myboxik{expanded}{#1}\myboxik{original}{#1}\myboxik{tex}{#1}\myboxik{hyphenate}{#1}\myboxik{none}{#1}\par\thinrule} \starttext

Re: [NTG-context] How to repeat the hyphen?

2019-03-22 Thread Taco Hoekwater
y way in ConTeXt how to set it by default? > # > > # > Best wishes, > # > > # > Tomáš > # > > # > %% MWE: > # > > # > \starttext\mainlanguage[cz] > # > > \def\myboxik#1#2{\start\setuphyphenation[cz][method=#1]\startframedtext[width=1dd]\hbox{{\bf#1}

  1   2   3   4   5   6   >